Pt_spiderBASE

[Home] [EST] [BlsresTxtSearch] [BLAST] [Info]

EST SEQ

EST sequence information
Clone IDSizeClone SEQ
At_eW_000_A01 712 caaaattttacaaagaataataatatttccttttgtatcaggaattattaaatttcattaaaaatatttaattcccgaaattttatgatctaaatatattaatcttaattatatatcaaaataattaataaattatatttagaagctaaacaccattcgaataaatttatatctggtttcttttcttgaaattaatttataaaaataaatttatatataaatataaatttttattatatatttattataaatatatacaagattaaaagtttctacaaagtataataactgcaattatatattacacttaataattaagtaaagatcatttttattatatataacaataatagtataagtaaattatcataaatttaattttcattttaatttattaattctttataaatataaattattaactaaaataattaaacgactgtttatcaaaaacatttcttatttattataataagtataacctgctcaatgatatattttaaatagccgcaatattctgtgctaaggtagcataatcatttgctttctaattaaaagctaaatgaaaggtttaacgttttaatttcttttttatttatatcttattaaaattttattaaatataaaaatatatttatataataaatagacgacaagaccctgttgaacttaactttatttagctggggcagcttattaattataattttaa
At_eW_000_A02 705 aagaaaaataaggttttatatatagatatatgtataaaaagagatttgatgagatatatatatatatatacatatacagcataaagaagtaaaagattctgccgatgaaatatgatgcttagatgggtgattatgcaaaaagagaggttttgtttgaatacggattttgatattgattgtttttgaactacctcctctctcttcaacaagttatccccgcgagaggggtggacgtcagacattctgagacagagagtagagaaaataaatttcgaattaactctctgggaaggattgaggaaaagggttggttgggggttggagaagaattttgaagaaataaaaaaatataaataaagagagagaaatttccattaaataaaattcttcatttccgagtcaaaaatgttgatcggtaccatttgagatgtctccgccacctcgcttttacctcatcatctagagaataatttgcaacacagatagcaatcatccaatccaaaagttgcagtttggactcgctttagtctctgtgtgggtaagcagttttttttcttctggaattgcgttgccggttttaataaaagacgatatgctttttttcttttttttatctcgtattttcgaatgcttttctatttgcatttgtgagatgttgatggaaaaataattaaaaacaaacacgtttttaccaagtgtttaaaa
At_eW_000_A03 567 gtggcatcgaagaaccaagtgtcgccattttgtttgctgttagtcttgtttctgtgaagtgtaaattgtatttgtttgtgtaattttcgttgtgacgtagtggtgattgtcaacttgtagtgctttattaccttggaactgtccattttcaagttgttgctttgttactttttattgccgtaaatctgctgtggaagcgcaaagtgctttacataatattaaaactctccctggaatgcatcaccctatccaaatgaaaccagctgatagtgaaaatagaaatgaaagaaaactttttgttggtatgctatcaaaaaaatgttcggaaaatgatgttagaattatgttttctgcctttggacaaatagaagaatgtactgtcttgcgagatattaatggacaaagtagaggctgtgcttttattacttatgcttctaggcagtgtgccattaatgctattaaagctatgaaccattctcagactatggagggttgtagtagtcccttagttgttaaatttgccgatacccaaaaggataaagatttaaaacgacagcaacagatgat
At_eW_000_A04 759 gcaatcgtcgtgtcgtggaacctgatttatcaaatgttgaatttgatacaagtgaagatgttgaaattattcccactttcgatgcaattggtcttagagaagatttacttcgtggtatctatgcatatggatttgagaaaccatcagcaattcaacaaagatcaatcaagcctgttatgaaaggaagagatgtcattgctcaagctcaatctggtactgggaaaacagctactttttccataggagttctccaaatgctggaaacagaaatgagggaaacacaagttcttatcctatcacctaccagggagttggctgttcaaattcaaaaggttatattagcccttggagattacatgaatgttcagtgtcatgcttgtattggaggaacaaatttgggagaagacatcagaaaattagattatggacagcatgtggtttctggtacacctggaagggtatttgatatgatcagaagaaggaatttaagaacaagatctataaaaatgcttgtactggacgaagccgatgaaatgttaaataaaggatttaaggatcaaatttacgacgtgtatcgatatttgccaccctgtacgcaagttgttttgatatctgccacacttcctcatgagattttagaaatgaccaacaagtttatgacggatcccatcaggatattagtcaaacgtgatgaattgacgctggagggtattaagcagttttttgtggctgttgaacgcgaagagtggaagttggaca
At_eW_000_A05 714 taaaaaaaaaaaaactcttgaaaaaaacattccaataaaatactacacttataacagcttatttaaaattttgatatttttactatttcgtggagtctgtagagatctgaactaagaaaatctttatctgactgcataattaattttcatacttcagacaaatttagttccccccacccctctttttttcccattgctctattcacctaactgttgatttaaagtaaaataagctcttaacatctggtctacaaggtgcatagcactcttgaaaagtgcttaaaggtgcttgtttttgatttacgttttttaaaagggggccttttttattattcgggatttgtgaagagtgcttattttttatcttttaaaaagagattttttctttgccgtgttgactgttctaaattataaataaatgcatgattttcacaattttctctgcaatattaatctgaaactagttgtgattatgcatcctgattatgaaaagtttttgaaaatagttctgaattttattgattttatgtttataaactaaaaactttcaatgataggaagaaaaaaaatatttatgactgcacatatcctaattaagatttttttttttttttggaaagttttttgagtgcttaaaaggtgcttattttttgtttaaaaatccagctacacactctgtctagtgataagtcagataaaaaaaaaaactgaact
At_eW_000_A06 823 gttaataaattgatgcagatatttttttacgaacaaagcaactttttaaatctctgaatatttttaaatatcaactgttgaccagatcttcccaaccaattttagacccacttacagtatgtgcctttgtgtgatttaaattgaaagtgtggattttttttttgtaatgttgtatatttagcttattaaaactaaaatgctttctttaatactataagccctgtgtacttacagtattaaaattgtcatatttttttgtaacattttatataacgacgaagcctggatttatttcaattgagttcccggatagcctgagattcaggctcatactaagcttccatccatataattctgcatttttgcactctttattaaatatttctttgtaccatgtttgccttgatgagtagtttataaattagataagtttacaacagtttcttagcttgtgtattttgagatatctctatccattgttaagtacgtttaaagtctgttttcttactcaattgagcttgtttaaaatggccggtagttttgtaaaacttagcttgtgactgtcactttttggagtttttaacgttaaatcacagtattgtttcctcctgttatgccatggaaatgtctgttaatctgttttattgctatcatttaactggtgcaaagggttacattgtccttaacatttgagtgttagcaaattgaaatatttatagacattaaatcaaacttgttatatttctctgtagtgcttaattttctatttatgagacgttatgtgccagtacagtatgtatttcgaaaagggtggaaattaatt
At_eW_000_A07 833 tgagtcttgacctttattcgaggttacttatatttaaatagaagacgaatattcttatcgatgtctggctttctcttttaagtcaattcagttcacggtcatgttttggatcatcctgttaacagttttttcggcagcgcacgcaaagcatgtgcggatatgtgttccggaatcattatcatcggcatgcaacgaaatggcttccgatctgcctgaaacattctcgtgtattactcaacctgacacttacggatgcttgaagaaagtgagcgttggtgatgccgatcttgtgaatgtagatccttcagctctgtatgtgggaggatttttctttaacttgcaacctataactactgaactggtggatggactgccccacagatatgaaggggttgctgtggtgagaaaacaatctgacatcgagtcagtggacgatctccagaacaagtcctcctgtcacacaggattggggcggactgtcggatggcagataccagtggggagactgctgcagtcccacacaatggccccagactgcgaagagggagagttggcagccgtccagaggttcttcgatggaagctgtgtgcctggacaatggtcatccgatcccgtcgtagagaaaaaactcaaatccaggtatccgaacttgtgcagtaggtgcaaagattcttcttcgtgctcaggagatgatgcatatgctggatacgaaggggtgatgaagtgtatctcagaaggagcggccgatgtagctttacaaaaatttctgcactcaggaatttctggataaaaatcctgatttcgaagaaaaggcagaactgctgtgctttcga
At_eW_000_A08 841 gggggagactgctctccttgttttttgtatacaatatacttcagtgtcacaattaaggatcccttttatcagacgacttttgttttgttagatgctttaacatcgtaactaaatattaatattaatgaaattcaatgtagaatatattgtaaatacaagattccggatttgactttttcagattaggcttagccacaccccattgcggcgtttagagacttggatgcaatcggctgatattagtattcctatttgaggttgctttaggaagatattatccataagcaacatcatggcttgttgcatgagtgatgaagccaaggaacaaaagcgtataaatcaagaaattgagaagcaacttcgtaaagataagcgtgatgcacggagagaattaaaattattattgttaggtactggcgagtctggtaaaagcactttcataaaacagatgagaattatccatggttctggttattctgatgaagataaaagaagctttatcaagctcgtctatcaaaacatttttatggccatgcagagcatgataaaagccatggaactactcaggatagagtataaaaacccagcaaaccatgatcatgctgaactggttagaagtgtggactttgagactgtgactacatttgaaactccttttgtgaatgccataagagcactatggaatgatcctggaatacaggaatgttatgacagaagaagagaatatcaattaacagattccgcaaagtattatctttgtgatttggaaaagaatagcactacctgattatctaccaacacaggcaagatattattacgagtaagagtaccaactactgga
At_eW_000_A09 827 gtttcgacttgttcctggagttagtaactagagtaaatagacgaagttttgcttccaagatataataataaataaatgtgatactcaatgaataaaatgaactccaatgtacgatggggttctcgaaaaaaagatgaaattgacttttctcaacttctttcagaacttgatgagttatttgctgatgaaccatttgatcctgagggatatgtagatcgtctttcatggcgaataggaggtattcagagagaaggtgaggcatttgatccaagctcactacacaaagcatttgagcatgccattctacatctgcagcaaagttatgaaaccaagcagcgtcagtgtggtacattagagatgctatgccgggaagaagagaaagctcactgggaaaaaacaaaagaacttatcgacaaaaataaggctgcttatgagacatttcatgaactcgatgaaagaatagattttgtagctacaaaagtagttcatctgggtgaccaactagagagtgtaaatactcctcgtgctcgtggcagtaagaagcacaaaattggatgattcnttttccagtttaatggattgcagaggctggcaaagaggatatcctaagtggaatcgttaagttangcttttggattccagtntggaccttcnttcaaaacttccatcctggattccacaggattaaccacctggaaangcccaanttggacctggcacgccaaggaaggattaggcaaaaaattntggatgnagatggacgcgagaccttatggatggaattggtgaangcccaccgagtctggtataaaggagcaaaantggag
At_eW_000_A10 781 aagaagccaggcaaaaagcagttggctgctatgcaagaagcattaaagaagatcaaagaagaagaggaacgtatgagactcgaagaagaagcaaaattaaaagctgaagaggaagctgaacagctacgtttggaaaaactaagattagaacaagaaaggaaagagaagaaaaaacaaaaagagaaggaaaagcgggaaaggctaaaagctgaaggaaaattattaactaagtctcagaagcaaaatcgtgctcgaatggaagctacactcgctgccctcagagaacaaggggttgaagtcccccaaattggagagaagaaagaaaaagcacctaggcttggtgatcgtaaaaaaactcctagaaagaaggcatctttgactgaagacacccttgaaacatctaagccagaagatcagaaagaagaatctcctgaagtgaaggaagaaacacccgaaataaaagagcccacgcctgttcccggtgaggaagaaaacatcaaagatgcctgggatgacacttcatctgaagatgaggaattagagaaacaagatgcaaaaggtgtcaaaaaaagttgagatcgtaacatcaaaaactgctaaaggtgctgaatctgaaacagagtcctctggtagtgaagattcttccgaagaagaatcggattcaggtgaagatagttctgacagtagctctgatagtgataaaacagaagaatcttcagaagaaaaaatacgcttacgaattcagaaacgacgagaacttgctgaaagcaatcgaagcctg
At_eW_0xx_[A-P]xx
eS7_0xx_[A-H]xx
eS7_SB_xxx_[A-H]xx
eS6_d1_xxf_[A-H]xx
S7_d1_xxf_[A-H]xx
field: find:
[Home] [EST] [BlsresTxtSearch] [BLAST] [Info]
Last updated, 2016.1.22